View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9690_low_17 (Length: 271)
Name: NF9690_low_17
Description: NF9690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9690_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 255
Target Start/End: Original strand, 699281 - 699535
Alignment:
| Q |
1 |
atggtgggaagagaaagatgttttcaaatcagaacctggtgaaaaccctccaaaaccgggtgaaaaattcttcggcaatttcccttttccttacacgaat |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
699281 |
atggtgggaagaggaagatgttttcaaatcagaacctggtgaaaaccctccaaaaccgggtgaaaaattcttcggcaatttcccttttccttacacgaat |
699380 |
T |
|
| Q |
101 |
ggttgccttcatttaggccatgcattttctctttccaagttggaattcgcagcggctttttaccgattgagaggcaccaatgtgcttctgccatttgcct |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
699381 |
ggttaccttcatttaggccatgcattttctctttccaagttggaattcgcagcagctttttaccgattgagaggcgccaatgtgcttctgccatttgcct |
699480 |
T |
|
| Q |
201 |
ttcattgtaccggcatgccgatgaaagcttctgctgataaactccctagagaaat |
255 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
699481 |
ttcattgtaccggcatgccgatgaaaacttctgctgataaactcgctagagaaat |
699535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 2 - 188
Target Start/End: Original strand, 697191 - 697377
Alignment:
| Q |
2 |
tggtgggaagagaaagatgttttcaaatcagaacctggtgaaaaccctccaaaaccgggtgaaaaattcttcggcaatttcccttttccttacacgaatg |
101 |
Q |
| |
|
|||||||||||| |||||| ||||| |||| ||| ||| ||||||||||||||| |||||| || || ||||| || ||||||||||||||||||| |
|
|
| T |
697191 |
tggtgggaagaggaagatgatttcatatcataacgcggttaaaaccctccaaaactaggtgaattgttttttggcaactttccttttccttacacgaatg |
697290 |
T |
|
| Q |
102 |
g-ttgccttcatttaggccatgcattttctctttccaagttggaattcgcagcggctttttaccgattgagaggcaccaatgtgcttc |
188 |
Q |
| |
|
| || ||||||||||||||||| || |||||| ||||||||||||||| ||||| | | ||||||| |||||| |||||||||||| |
|
|
| T |
697291 |
gtttaccttcatttaggccatgtatcttctctgtccaagttggaattcattgcggc-tatcaccgatttagaggcgccaatgtgcttc |
697377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 23262854 - 23262615
Alignment:
| Q |
1 |
atggtgggaagagaaagatgttttcaaatcagaacctggtgaaaaccctccaaaaccgggtgaaaaattcttcggcaatttcccttttccttacacgaat |
100 |
Q |
| |
|
|||||||||||||||| | ||||||||||| ||||| ||| | || || || || ||||||||||||||||| ||||||||||||||||| | ||| |
|
|
| T |
23262854 |
atggtgggaagagaaacaagttttcaaatctgaacccggtaacaaaccacctcaagaaggtgaaaaattcttcgggaatttcccttttccttatatgaac |
23262755 |
T |
|
| Q |
101 |
ggttgccttcatttaggccatgcattttctctttccaagttggaattcgcagcggctttttaccgattgagaggcaccaatgtgcttctgccatttgcct |
200 |
Q |
| |
|
|||| | | |||||||| ||||| ||||| |||||||| | ||||| || ||||| ||| | || | | ||| | ||||| ||| |||||||||| | |
|
|
| T |
23262754 |
ggttacttacatttaggtcatgctttttcgctttccaaacttgaatttgctgcggcgtttcatcgtcttcgcggcgcgaatgttcttttgccatttgctt |
23262655 |
T |
|
| Q |
201 |
ttcattgtaccggcatgccgatgaaagcttctgctgataa |
240 |
Q |
| |
|
|||||||||| || ||||| || || |||||||||||||| |
|
|
| T |
23262654 |
ttcattgtactggtatgcctattaaggcttctgctgataa |
23262615 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University