View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9690_low_25 (Length: 245)
Name: NF9690_low_25
Description: NF9690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9690_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 42840988 - 42841204
Alignment:
| Q |
17 |
atcatcttatagtcatctttcacacgatcataaccaacttgataataatgggcccaccaatcattcgaagaatgattaggtttaaccaaaggaataaact |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42840988 |
atcatcttatagtcatctttcacacgatcataac-aacttgataataatgggcccaccaatcattcgaagaatgattaggtttaaccaaaggaataaact |
42841086 |
T |
 |
| Q |
117 |
tgaattcctcggtagtcgggttccacaatataaatcttgtatctctatcttcaatgtcatgatatttgagacaaagagtgccattaaaactatgagaacg |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
42841087 |
tgaagtcctcggtagtcgggttccacaatataaatcttgtatctctatcttcaatgttatgatatttgagacaaagagtgccattaaaactaagagaaag |
42841186 |
T |
 |
| Q |
217 |
cacaatttcataacctat |
234 |
Q |
| |
|
||||||||| ||||||| |
|
|
| T |
42841187 |
cacaatttcgaaacctat |
42841204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University