View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9690_low_33 (Length: 238)
Name: NF9690_low_33
Description: NF9690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9690_low_33 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 16 - 189
Target Start/End: Original strand, 55506416 - 55506589
Alignment:
| Q |
16 |
tttccaactttcttggatagattctactctcctggnnnnnnncgaacaacaattcctaaatttagactttgttgatgttgtttgctttgtactcttgttc |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55506416 |
tttccaactttcttggatagattctactctcctggaaaaaaacgaacaacaattcctaaatttagactttgttgatgttgtttgctttgtactcttgttc |
55506515 |
T |
 |
| Q |
116 |
ccttgccatggtttatccccctggattttcctgacaaggtcttattgatgcaaatgttgagttcgcttcgttcg |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55506516 |
ccttgccatggtttatccccctggattttcctgacaaggtcttattgatgcaaatgttgagttcgcttcgttcg |
55506589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 140 - 187
Target Start/End: Original strand, 43996514 - 43996561
Alignment:
| Q |
140 |
attttcctgacaaggtcttattgatgcaaatgttgagttcgcttcgtt |
187 |
Q |
| |
|
|||||||| ||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
43996514 |
attttcctcacaaggtcttattgatgtgaatgttgagttctcttcgtt |
43996561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University