View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9691_low_14 (Length: 284)
Name: NF9691_low_14
Description: NF9691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9691_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 44 - 271
Target Start/End: Complemental strand, 13925349 - 13925122
Alignment:
| Q |
44 |
accttatttaatccctcgcttgacgagttcttccacacaacctaccctctctcttccgtctttacagaagtaagccctactgccattgccacacaatacc |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13925349 |
accttatttaatccctcgcttgacgagttcttccacacaacctaccctttctcttccgtctttacagaagtaacccctactgccattgccacacaatacc |
13925250 |
T |
|
| Q |
144 |
cttcgaacaaacaaaaccttgatctcattgttgggtcttgccacggaatcatatgtttcgacctggatcgaggtttcactctattgtggaacccttccat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13925249 |
cttcgaacaaacaaaaccttgatctcattgttgggtcttgccatataatcatatgtttcgacctggatcgaggtttcactctattgtggaacccttccat |
13925150 |
T |
|
| Q |
244 |
aagaaaattttccgagttgccttcctct |
271 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
13925149 |
aagaaaattttccgagttgccttcctct |
13925122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 13944136 - 13944089
Alignment:
| Q |
1 |
tttttcaaatttatagctgatgttcttacatacattatcatttacctt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13944136 |
tttttcaaatttatagctgatgttcttacatacattatcatttacctt |
13944089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 14085325 - 14085278
Alignment:
| Q |
1 |
tttttcaaatttatagctgatgttcttacatacattatcatttacctt |
48 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14085325 |
tttttcaaatttatagctgatgttcttacatacattatcatttacctt |
14085278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University