View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9691_low_20 (Length: 250)
Name: NF9691_low_20
Description: NF9691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9691_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 1 - 101
Target Start/End: Original strand, 50558196 - 50558296
Alignment:
| Q |
1 |
cacgaagacgaggacttttttcacaaacctgttacagtggtcaaaaaatgacaaatgcataaacatgtgtgcttaaaaaattgtgatttaaacacagtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50558196 |
cacgaagacgaggacttttttcacaaacctgttacagtggtcaaaaaacgacaaatgcataaacatgtgtgcttaaaaaattgtgatttaaacacagtat |
50558295 |
T |
|
| Q |
101 |
c |
101 |
Q |
| |
|
| |
|
|
| T |
50558296 |
c |
50558296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 159 - 238
Target Start/End: Original strand, 50558354 - 50558433
Alignment:
| Q |
159 |
atagactacaatgaaaatcgtacatacagcacagaaacatagagcaaaaatttagggagagggttgctaccttgcaccta |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50558354 |
atagactacaatgaaaatcgtacatacagcacagaaacatagagcaaaaatttagggagagggttgctaccttgcaccta |
50558433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University