View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9691_low_28 (Length: 215)
Name: NF9691_low_28
Description: NF9691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9691_low_28 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 19 - 201
Target Start/End: Complemental strand, 35520754 - 35520572
Alignment:
| Q |
19 |
cctctaacatggtatatgtattttcttcaatattggaaactatcaccgctttacccgaatacagtgcaaagaccatgcaatgaccctcaatggaagaaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35520754 |
cctctaacatggtatatgtattttcttcaatgttggaaactatcaccgctttacctgaatacagtgcaaagaccatacaatgaccctcaatggaagaaaa |
35520655 |
T |
|
| Q |
119 |
tattactttgcgaatgctgcaaaaataatgaaaatcaatttcacctttaagattactaggagtatatagttcaaacaactcca |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35520654 |
gattactttgcgaatgctgcaaaaataatgaaaatcaatttcacctttaagattactaggagtatatagttcaaacaactcca |
35520572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 39 - 129
Target Start/End: Original strand, 38813631 - 38813721
Alignment:
| Q |
39 |
ttttcttcaatattggaaactatcaccgctttacccgaatacagtgcaaagaccatgcaatgaccctcaatggaagaaaatattactttgc |
129 |
Q |
| |
|
|||||| ||||||||||||| ||| | ||||| | || ||||||||||||||||||| |||||||||| ||| | || |||||||||| |
|
|
| T |
38813631 |
ttttctccaatattggaaacagtcaactctttatcattatgcagtgcaaagaccatgcaacgaccctcaatagaaaacaagattactttgc |
38813721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University