View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9691_low_5 (Length: 434)
Name: NF9691_low_5
Description: NF9691
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9691_low_5 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 258; Significance: 1e-143; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 258; E-Value: 1e-143
Query Start/End: Original strand, 21 - 290
Target Start/End: Complemental strand, 31750012 - 31749743
Alignment:
| Q |
21 |
tatcacatgccgaaccaatacggcgtaatggtaaggtaaccgtggaatgaaacagggcttgctaaacaatgaatgctagttcttggtctaaacaaaatca |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31750012 |
tatcacatgccgaaccaatacggcgtaatggtaaggtaaccgtggaatgaaacagggcttgctaaacaatgaacgctagttcttggtctaaacaaaatca |
31749913 |
T |
 |
| Q |
121 |
gtattagataaaacttcaaaaataggttgacagtatagaaaataacaagtaaatcacaacgcataaacaaaaactgacaattcaaatgttttcttctcca |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31749912 |
gtattagataaaacttcaaaaataggttgacagtatagaaaataacaagtaattcacaacgcatacacaaaaactgacaattcaaatgttttcttctcca |
31749813 |
T |
 |
| Q |
221 |
tctcacaaaaatggttcccaaaaattgtctaccttcccacatatctaaatccatctctcacgttttaatt |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31749812 |
tctcacaaaaatggttcccaaaaattgtctaccttcccacatatctaaatccatctctcacgttttaatt |
31749743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 349 - 426
Target Start/End: Complemental strand, 31749677 - 31749600
Alignment:
| Q |
349 |
aattcaagatgggtgtaggagggacttcgagagtgattccagcttggatttgaccccacccaataagacgcctatgct |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31749677 |
aattcaagatgggtgtaggagggacttcgagagtgattccagcttggatttgaccccacccaataagacgccaatgct |
31749600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 365 - 426
Target Start/End: Original strand, 28866742 - 28866803
Alignment:
| Q |
365 |
aggagggacttcgagagtgattccagcttggatttgaccccacccaataagacgcctatgct |
426 |
Q |
| |
|
||||||||| || || ||||| |||||||||||||| ||||| ||||| ||||||| ||||| |
|
|
| T |
28866742 |
aggagggacatcaagggtgataccagcttggatttggccccaaccaatgagacgccaatgct |
28866803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University