View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9692_low_14 (Length: 312)
Name: NF9692_low_14
Description: NF9692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9692_low_14 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-112; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 64 - 294
Target Start/End: Original strand, 422613 - 422843
Alignment:
| Q |
64 |
ttcaacacaattgttagaatgacataaacaactcatctaatgtaacaatgacttgaattttttgttgctcttttttcagtttcatatatgcactcgattc |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
422613 |
ttcaacacaattgttagaatgacataaacaactcatctaatgtaacaatgacttgaattttttgttgctcttttttcagtttcatatatgcactcgattc |
422712 |
T |
 |
| Q |
164 |
tcatcaagactagcatctcaaggtttcatgctgnnnnnnnctttattcacaaatgtttgtgattatttgtttgctttccttgacattatgactttgtttt |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
422713 |
tcatcaagactagcatctcaaggtttcatgctgtttttttctttattcacgaatgtttgtgattatttgtttgctttccttgacattatgactttgtttt |
422812 |
T |
 |
| Q |
264 |
atatgttatatgcaaaatttcaactcattta |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
422813 |
atatgttatatgcaaaatttcaactcattta |
422843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University