View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9692_low_8 (Length: 352)
Name: NF9692_low_8
Description: NF9692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9692_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 18 - 342
Target Start/End: Original strand, 43290058 - 43290382
Alignment:
| Q |
18 |
acttttgtgaatctttttcctgctttgtcgaaattgggtgattctagaactgtgaagatgttttatgggtttatgaggaaatttggtgatcagtatgtta |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43290058 |
acttttgtgaatctttttcctgctttgtcgaaattgggtgattctagaactgtgaagatgttttatgggtttatgaggaaatttggtgatcagtatgtta |
43290157 |
T |
|
| Q |
118 |
gtgatgtgtttgttgtaagctctgcgatacttatgttttctgatgttggttgtatggattatgcgcgaatggtttttgatcgatgtttgaataaaaatac |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43290158 |
gtgatgtgtttgttgtaagctctgcgatacttatgttttctgatgttggttgtatggattatgcgcgaatggtttttgatcgatgtttgaataaaaatac |
43290257 |
T |
|
| Q |
218 |
tgagatttggaatactatgattgttgcgtatgttcaaaataattgcccggttgaagcgattgatgtgtttattcaagcgttggagtcggaggagggtgta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43290258 |
tgagatttggaatactatgattgttgcgtatgttcaaaataattgcccggttgaagcgattgatgtgtttattcaagcgttggagtcggaggagggtgta |
43290357 |
T |
|
| Q |
318 |
tgcgatgatgtaactttgctctctg |
342 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
43290358 |
tgcgatgatgtaactttgctctctg |
43290382 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University