View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9692_low_9 (Length: 347)
Name: NF9692_low_9
Description: NF9692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9692_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 153 - 274
Target Start/End: Original strand, 49766980 - 49767101
Alignment:
| Q |
153 |
cgagtttaccaagtttttcttgaagacaaaaagcacagatcccaccagggttgtttctgtatggatgatcaatgcattgcatgccatcaatggaatcatc |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49766980 |
cgagtttaccaagtttttcttgaagacaaaaagcacagatcccaccagggttgtttctatatggatgatcaatgcattgcatgccatcaatggaatcatc |
49767079 |
T |
|
| Q |
253 |
ttcaacaccaatgttaactctt |
274 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
49767080 |
ttcaacaccaatgttaactctt |
49767101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 49766825 - 49766881
Alignment:
| Q |
1 |
agttgtagctgatacagtgttgatg---gaagaagaagaaggacaatgacgagtagt |
54 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
49766825 |
agttgttgctgatacagtgttgatggaagaagaagaagaaggacaatgacgagtagt |
49766881 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 155 - 201
Target Start/End: Complemental strand, 14137753 - 14137707
Alignment:
| Q |
155 |
agtttaccaagtttttcttgaagacaaaaagcacagatcccaccagg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
14137753 |
agtttaccaagtttttcttgaagacaaaaagcacatataccaccagg |
14137707 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University