View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9693_low_16 (Length: 240)
Name: NF9693_low_16
Description: NF9693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9693_low_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 1 - 110
Target Start/End: Complemental strand, 14718636 - 14718528
Alignment:
| Q |
1 |
aaccatttggttcgatttttcaaacgttgaatcaatcaaccccatatatttcatgtcagcaatgtatttttgtttttggctctagaggcttcagagtttt |
100 |
Q |
| |
|
||||||||||||| |||||| |||| ||||||||| ||||||||||||||||||||||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
14718636 |
aaccatttggttcaatttttgaaacattgaatcaaacaaccccatatatttcatgtcagttttgta-ttttgtttttggctgtagaggcttcagagtttt |
14718538 |
T |
|
| Q |
101 |
gataattctt |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
14718537 |
gataattctt |
14718528 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 106 - 174
Target Start/End: Complemental strand, 14718420 - 14718352
Alignment:
| Q |
106 |
ttcttaatatattagtcctttaaacgaagccagttcttttgctcgtcaagtttttcctttcttttcttt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
14718420 |
ttcttaatatattagtcctttaaacgaagccagttctgttgttcgtcaagtttttcctttcttttcttt |
14718352 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 106 - 174
Target Start/End: Original strand, 10943194 - 10943262
Alignment:
| Q |
106 |
ttcttaatatattagtcctttaaacgaagccagttcttttgctcgtcaagtttttcctttcttttcttt |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
10943194 |
ttcttaatatattagtcctttaaacgaagccaattctgttgctcgtccggtttttcctttcttttcttt |
10943262 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 67 - 110
Target Start/End: Original strand, 10943043 - 10943086
Alignment:
| Q |
67 |
tttttgtttttggctctagaggcttcagagttttgataattctt |
110 |
Q |
| |
|
|||||||||||| || |||||| ||||||||||||||||||||| |
|
|
| T |
10943043 |
tttttgtttttgcctgtagaggtttcagagttttgataattctt |
10943086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University