View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9693_low_22 (Length: 209)
Name: NF9693_low_22
Description: NF9693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9693_low_22 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 105; Significance: 1e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 22 - 138
Target Start/End: Complemental strand, 8028773 - 8028657
Alignment:
| Q |
22 |
ttacatgtcaaatagtgtattggaacatgtttagttattttgtgatttatgtttgactcataaaatgcatcgtgaaatgatgcttgtggtttgaatgact |
121 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
8028773 |
ttacatgtcaaatagtatattggaacatgtttagttattttgtgatttgtgtttgactcataaaatgcatcgtgaaatgatgcttgtggtttggatgact |
8028674 |
T |
|
| Q |
122 |
ggcttgtgtttgagcta |
138 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
8028673 |
ggcttgtgtttgagcta |
8028657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 194
Target Start/End: Complemental strand, 8028630 - 8028596
Alignment:
| Q |
160 |
aaagtgtgtgtgagctatttgaaaagcataaaatg |
194 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8028630 |
aaagtgtgtgtgagctatttgaaaagcttaaaatg |
8028596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University