View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9694_5 (Length: 354)
Name: NF9694_5
Description: NF9694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9694_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 19 - 188
Target Start/End: Complemental strand, 6175753 - 6175588
Alignment:
| Q |
19 |
cattatgcaacaactataactagttagttgatgatactttcacaaatccatggcatggaatgggaagagaaggacatggacatggacatggtatggagga |
118 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6175753 |
cattatgcaacaactataactagtt----gatgatactttcacaaatccatggcatggaatgggaagagaaggacatggacatggacatggtatggagga |
6175658 |
T |
|
| Q |
119 |
aagatttgtgtgcgggttttgtatcatatcatttcacgctactcactatcaccaacaccccacgcgccac |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6175657 |
aagatttgtgtgcgggttttgtatcatatcatttcacgctactcactatcaccaacaccccacgcgccac |
6175588 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 248 - 330
Target Start/End: Complemental strand, 6174988 - 6174906
Alignment:
| Q |
248 |
gcacattggcatgtgtgacaaagttaattgtgtcatatagtataacacgaaggaagtaattttgagtatattgatatttgatg |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6174988 |
gcacattggcatgtgtgacaaagttaattgtgtcatatagtataacacgaaggaagtaattttgagtatattgatatttgatg |
6174906 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University