View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9695_low_4 (Length: 241)
Name: NF9695_low_4
Description: NF9695
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9695_low_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 42518328 - 42518554
Alignment:
| Q |
1 |
ataaagtgtccataacaaataacgtggtaataatttaactgctaaaaaagttgtttctgttctgtcttcgtgaatcttcacgttgtgaatttacttcaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42518328 |
ataaagtgtccataacaaataacgtggtaataatttaactgctaaaaaagttgtttctgttctgtcttcgtgaatcttcacgttgtgaatttacttcaga |
42518427 |
T |
|
| Q |
101 |
catagagagagacagtggaaaagcttaaagctgctgtataaaaaccatcagtgtctactagannnnnnnnnnnnnnnnnncttgtgagcgagaaagtaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
42518428 |
catagagagagacagtggaaaagcttaaagctgctgtataaaaaccatcagtgtctactagagagtgtgtgtgtgtgtgtcttgtgagcgagaaagtaaa |
42518527 |
T |
|
| Q |
201 |
gtacgtgtacctgcttgagttgtttct |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
42518528 |
gtacgtgtacctgcttgagttgtttct |
42518554 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University