View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9696_1D_high_13 (Length: 241)
Name: NF9696_1D_high_13
Description: NF9696_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9696_1D_high_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 173 - 231
Target Start/End: Original strand, 46110411 - 46110469
Alignment:
| Q |
173 |
aataaaacaggaggcaatcctttcggatctttggggtgttgttagtcatcatagagacc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| |
|
|
| T |
46110411 |
aataaaacaggaggcaatcctttcggatcttcggagtgttgttagtcatcatagagacc |
46110469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 71 - 119
Target Start/End: Original strand, 30458851 - 30458899
Alignment:
| Q |
71 |
ttgactttagcttttggtaagtgatatggtgatctcataatagttttaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30458851 |
ttgactttagcttttggtaagtgatatggtgatctcataatagttttaa |
30458899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 111 - 149
Target Start/End: Original strand, 30459277 - 30459315
Alignment:
| Q |
111 |
tagttttaaagggatgtcaagttgcaagggaggaaaatt |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30459277 |
tagttttaaagggatgtcaagttgcaagggaggaaaatt |
30459315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University