View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9696_1D_high_18 (Length: 202)
Name: NF9696_1D_high_18
Description: NF9696_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9696_1D_high_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 21 - 195
Target Start/End: Original strand, 42156132 - 42156301
Alignment:
| Q |
21 |
ctttaaagcttcttggaatgtcttaaacgaaattgtctgaattcaattaattgggtaagttggaataattaaggtgtgcctaccaaaggaggaaggagga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |
|
|
| T |
42156132 |
ctttaaagcttcttggaatgtcttaaacgaaattttctgaattcaattaattgggtaagttggaa----taaggtgtgcctaccaaaggatgaaggagga |
42156227 |
T |
 |
| Q |
121 |
ttaggagtaaaaataaaattgaaattgtgtaatttggcccgcttgagtaagtgaagatggataaatttatcatct |
195 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42156228 |
ttaggagtaaaaa-aaaattgaaattgtgtaatttgtcccgcttgagtaagtgaagatggataaatttatcatct |
42156301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University