View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9696_1D_low_17 (Length: 307)
Name: NF9696_1D_low_17
Description: NF9696_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9696_1D_low_17 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 259; Significance: 1e-144; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 259; E-Value: 1e-144
Query Start/End: Original strand, 7 - 297
Target Start/End: Complemental strand, 7478577 - 7478287
Alignment:
| Q |
7 |
aacatctatttagacgtggtgctggatgattgtcatgctggaaggttagttaaaggatgaaccggttttgtctatgacatgaagaatcatgctatgatgt |
106 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7478577 |
aacatctatttagacgcggtgctggatgattgtcatgctggaaggttagttaaaggatgaaccggttttgtctatgacatgaagaatcatgctatgatgt |
7478478 |
T |
|
| Q |
107 |
ttgcttgctcctttgcaatttcattattatggtcatatccgaatcaaaagctacatttttatcctagttattaatcaaatttaaactccaggtgaaacta |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |
|
|
| T |
7478477 |
ttgcttgctcctttgcaatttcattattatggtcatatccgaatcaaaagctacatttttatcttagtgattaatcaaatttaaactccaggtgaaacta |
7478378 |
T |
|
| Q |
207 |
aacttagatcatttggctctagaattcgagtccaaatgaaaaacacttagttgttgatggggttacgtcgttgaatgtatataattaacac |
297 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||| ||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
7478377 |
aacttagatcatttggctctcgaattcgagttcaaatgaaaaacacttggttgttgatggagttatgtcgttgaatgtatataattaacac |
7478287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University