View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9696_1D_low_27 (Length: 241)

Name: NF9696_1D_low_27
Description: NF9696_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9696_1D_low_27
NF9696_1D_low_27
[»] chr3 (1 HSPs)
chr3 (173-231)||(46110411-46110469)
[»] chr6 (2 HSPs)
chr6 (71-119)||(30458851-30458899)
chr6 (111-149)||(30459277-30459315)


Alignment Details
Target: chr3 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 173 - 231
Target Start/End: Original strand, 46110411 - 46110469
Alignment:
173 aataaaacaggaggcaatcctttcggatctttggggtgttgttagtcatcatagagacc 231  Q
    ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||    
46110411 aataaaacaggaggcaatcctttcggatcttcggagtgttgttagtcatcatagagacc 46110469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 49; Significance: 4e-19; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 71 - 119
Target Start/End: Original strand, 30458851 - 30458899
Alignment:
71 ttgactttagcttttggtaagtgatatggtgatctcataatagttttaa 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
30458851 ttgactttagcttttggtaagtgatatggtgatctcataatagttttaa 30458899  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 111 - 149
Target Start/End: Original strand, 30459277 - 30459315
Alignment:
111 tagttttaaagggatgtcaagttgcaagggaggaaaatt 149  Q
    |||||||||||||||||||||||||||||||||||||||    
30459277 tagttttaaagggatgtcaagttgcaagggaggaaaatt 30459315  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University