View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9696_1D_low_29 (Length: 236)
Name: NF9696_1D_low_29
Description: NF9696_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9696_1D_low_29 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 103 - 222
Target Start/End: Complemental strand, 42667614 - 42667495
Alignment:
| Q |
103 |
catcaaggacattgaagtacacacgtctttgaaaggaaagaacaagaagaagcaaggatcagaaacgcatcaatctgaaaagattgagaaaacaaaaaat |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667614 |
catcaaggacattgaagtacacacgtctttgaaaggaaagaacaagaagaagcaaggatcagaaacgcatcaatctgaaaagattgagaaaacaaaaaat |
42667515 |
T |
|
| Q |
203 |
aacactgctgcagagagaaa |
222 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
42667514 |
aacactgctgcagagagaaa |
42667495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 9 - 75
Target Start/End: Complemental strand, 42667708 - 42667642
Alignment:
| Q |
9 |
gagatgaacagtggcgatttagcgatgatactcatgttaaccgttatcgtggattggacttaaactt |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42667708 |
gagatgaacagtggcgatttagcgatgatactcatgttaaccgttatcgtggattggacttaaactt |
42667642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University