View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9696_1D_low_30 (Length: 230)
Name: NF9696_1D_low_30
Description: NF9696_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9696_1D_low_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 114; Significance: 6e-58; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 114; E-Value: 6e-58
Query Start/End: Original strand, 20 - 211
Target Start/End: Complemental strand, 32369213 - 32369025
Alignment:
| Q |
20 |
tgcaaggtgtaacagcgtgatagttgcgcttccattccatcatcaccagaagcaaagtcgaagttgttcacatcagagccaaaaacgtcgtcgttcactg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32369213 |
tgcaaggtgtaacagcgtgatagttgcgcttccattccatca---ccagaagcaaagtcgaagttgttcacatcagagccaaaaacgtcgtcgttcactg |
32369117 |
T |
 |
| Q |
120 |
nnnnnnnnnnnnnnnnnnnnggagtagcaaatagcaacaagatcaatgagacagcacaagcaagtagcatccgctgcgagaccgaagattct |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32369116 |
ctctctctctctctctctctggagtagcaaatagcaacaagatcaatgagacagcacaagcaagtagcatctgctgcgagaccgaagattct |
32369025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University