View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9696_1D_low_31 (Length: 220)
Name: NF9696_1D_low_31
Description: NF9696_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9696_1D_low_31 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 36958237 - 36958410
Alignment:
| Q |
1 |
tgacaacacctaaccatgaattgcatctgcccttgatggtacacgagtcattacct-cgtctttcttcaacgttgttggctgatgcaataggatgttctt |
99 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36958237 |
tgaccacacctaaccatgaattgcatctgcccttgatggtacatgagtcattaccttcgtctttcttcaacgttgttggctgatgcaataggatgttctt |
36958336 |
T |
|
| Q |
100 |
tactatgatgtagnnnnnnnnnncttcgctttttctcatgtaataaataaaaattaccaaaattgtaacgtaat |
173 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36958337 |
tactatgatgtagttttttttttcttcgctttttctcatgtaataaataaaaattaccaaaattgtaacgtaat |
36958410 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University