View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9696_1D_low_35 (Length: 215)
Name: NF9696_1D_low_35
Description: NF9696_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9696_1D_low_35 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 22617754 - 22617551
Alignment:
| Q |
1 |
gtcgttgaatgacattgatgtgagtggatgtgtagcatcgagcacaaaagaaccaaaactggtgtctgcttcaaaggtagctgcagttgctcgcagttga |
100 |
Q |
| |
|
||||||| |||||||||||||| ||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
22617754 |
gtcgttggatgacattgatgtgggtggatgtgaagcatcgagcacaaaagaaccaaaaatggtgtctgcttcaaaggtagctgcagttgctcgcagctga |
22617655 |
T |
|
| Q |
101 |
gagtgtgttttgagttgttgacgtcgatgtccaagtccgttgtcctttccttctgttttgttttggtttttaattgtcgcgttgaactcttctgttgcat |
200 |
Q |
| |
|
||||||| || ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22617654 |
gagtgtggttccagttgttgatgtcgatgtccaagtccgttgtcctttccttctgttttgttttggtttttaattgtcgcgttgaactcttctgttgcat |
22617555 |
T |
|
| Q |
201 |
tatg |
204 |
Q |
| |
|
|||| |
|
|
| T |
22617554 |
tatg |
22617551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 126 - 206
Target Start/End: Complemental strand, 10980820 - 10980740
Alignment:
| Q |
126 |
gatgtccaagtccgttgtcctttccttctgttttgttttggtttttaattgtcgcgttgaactcttctgttgcattatgtt |
206 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
10980820 |
gatgtccaagtctgttgtcctttcattctgttttgttttggtttttaattgtcgcgttgaaatcttcggttgcattttgtt |
10980740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 9 - 92
Target Start/End: Complemental strand, 10981086 - 10981003
Alignment:
| Q |
9 |
atgacattgatgtgagtggatgtgtagcatcgagcacaaaagaaccaaaactggtgtctgcttcaaaggtagctgcagttgctc |
92 |
Q |
| |
|
||||||||||||| |||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
10981086 |
atgacattgatgtaggtgggtgtgaagcatcgagcacaaaagaaccaaaattggtgtctgcttcaaaggtagatgcagttgctc |
10981003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University