View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9696_1D_low_42 (Length: 201)
Name: NF9696_1D_low_42
Description: NF9696_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9696_1D_low_42 |
 |  |
|
| [»] chr6 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 139; Significance: 6e-73; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 139; E-Value: 6e-73
Query Start/End: Original strand, 55 - 201
Target Start/End: Original strand, 23332595 - 23332741
Alignment:
| Q |
55 |
atatgtggacgaatgagcgatagaagcgcatgaccgatccaccctcacgttggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
154 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332595 |
atatatggacgaatgagcgatagaagcgcatgaccgatccaccctcacgtgggacaatcattttcgacatgggaggaagaaatttgttaggatagttgat |
23332694 |
T |
 |
| Q |
155 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggct |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23332695 |
ttcgactcctgatctctctgcgatagtcatatctagaagattcggct |
23332741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 23322331 - 23322373
Alignment:
| Q |
18 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
60 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23322331 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23322373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 18 - 60
Target Start/End: Original strand, 23332498 - 23332540
Alignment:
| Q |
18 |
gacatcaccaaacacaatcgttgtaaaatccaaacgcatatgt |
60 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
23332498 |
gacatcaccaaacacaaacgttgtaaactccaaacgcatatgt |
23332540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University