View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9696_2D_low_15 (Length: 299)
Name: NF9696_2D_low_15
Description: NF9696_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9696_2D_low_15 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 25 - 283
Target Start/End: Original strand, 22564065 - 22564323
Alignment:
| Q |
25 |
cgtccgattcatcaccttcatcagtattgttctctacatcgccatcatcggaggcaggttgcttgctagcttgagatgtttgaatactaaggccttttgg |
124 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||| | |||||||| | |
|
|
| T |
22564065 |
cgtccgattcatcaccttcatcagtgttgttctctacatcgtcatcatcggaggcaggttgattgctagcttgagatgtttgaatgtttaggcctttagc |
22564164 |
T |
|
| Q |
125 |
aatttttaacctaaccaccaacctgtacttttcattgtttttaccacttgtttgcagcacaccaccttgttcattgatcttctcatcatcatcgacattg |
224 |
Q |
| |
|
||||||||||| || |||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
22564165 |
aatttttaaccgaaaaaccaacctgttcttttcattgtttttaccacttgtttgcatcacaccaccttgttcattgatcttctcatcatcatcgacactg |
22564264 |
T |
|
| Q |
225 |
ctgcaaagtttcattcttttactgtcacggtgattcacattaagattggcagatgattg |
283 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22564265 |
ctgcaaagtttcattcttttattgtcacggtgattcacattaagattggcagatgattg |
22564323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 179 - 260
Target Start/End: Original strand, 22573773 - 22573854
Alignment:
| Q |
179 |
cagcacaccaccttgttcattgatcttctcatcatcatcgacattgctgcaaagtttcattcttttactgtcacggtgattc |
260 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||| | ||| ||||||| || |||||| || ||| | ||| ||||||||||| |
|
|
| T |
22573773 |
cagcacaccaccttgttctttgatcttcccattcttatccacattgcggcgaagtttgatccttctcctgacacggtgattc |
22573854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University