View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9696_2D_low_20 (Length: 262)
Name: NF9696_2D_low_20
Description: NF9696_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9696_2D_low_20 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 1 - 248
Target Start/End: Original strand, 56169038 - 56169285
Alignment:
| Q |
1 |
tgatatcattgtcattgctattgttatgcctgactagagttgctacctgtttattatatttctaacaagaattgataattttagatgacaatcttttgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56169038 |
tgatatcattgtcattgctattgttatggctgactagagttgctacctgtttattatatttctaacaagaattgataattttagatgacaatcttttgat |
56169137 |
T |
|
| Q |
101 |
tggtcttgttatttggcattaacgtttgtcttatgcctattatgatataatgctttttatcatttaactttagtgtttgtcttttatgattttgtttatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
56169138 |
tggtcttgttatttggcattaacgtttgtcttatgcctattatgatataatgctttttatcatttcactttagtgtttgtcttttatgattttgtttatc |
56169237 |
T |
|
| Q |
201 |
actttctctaggctgtgctaacctattttatgtaaatttgctgatgtc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56169238 |
actttctctaggctgtgctaacctattttatgtaaatttgctgatgtc |
56169285 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 155
Target Start/End: Complemental strand, 706676 - 706522
Alignment:
| Q |
1 |
tgatatcattgtcattgctattgttatgcctgactagagttgctacctgtttattatatttctaacaagaattgataattttagatgacaatcttttgat |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
706676 |
tgatatcattgccattgctattgttatgcctgactagagttgctacctgtttattatatttctaacaagaattgatagttttagatgacaatcttttgat |
706577 |
T |
|
| Q |
101 |
tggtcttgttatttggcattaacgtttgtcttatgcctattatgatataatgctt |
155 |
Q |
| |
|
|||||||||||||||| |||| ||||| |||||| |||||||||||||||||| |
|
|
| T |
706576 |
tggtcttgttatttggtgttaatctttgttttatgcttattatgatataatgctt |
706522 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University