View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9696_2D_low_8 (Length: 401)
Name: NF9696_2D_low_8
Description: NF9696_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9696_2D_low_8 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 111; Significance: 6e-56; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 111; E-Value: 6e-56
Query Start/End: Original strand, 228 - 342
Target Start/End: Original strand, 28223669 - 28223783
Alignment:
| Q |
228 |
cttttcaggcattttccttccaaacgaagacaaatcaccaaattggtgagaatgattgcgtcattagagaatccacaatgaatgtacccaaccatgtgaa |
327 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28223669 |
cttttctggcattttccttccaaacgaagacaaatcaccaaattggtgagaatgattgcgtcattagagaatccacaatgaatgtacccaaccatgtgaa |
28223768 |
T |
|
| Q |
328 |
aatgaaacatcacac |
342 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
28223769 |
aatgaaacatcacac |
28223783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 338 - 401
Target Start/End: Original strand, 28224475 - 28224538
Alignment:
| Q |
338 |
cacacattaccgaaaaaatgtacgttcaaaaaataaatcagtaacagtttctttcacactgcac |
401 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28224475 |
cacactttaccgaaaaaatgtacgttcaaaaaataaatcagtaacagtttctttcacactgcac |
28224538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University