View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9696_low_6 (Length: 399)
Name: NF9696_low_6
Description: NF9696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9696_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 345; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 345; E-Value: 0
Query Start/End: Original strand, 4 - 384
Target Start/End: Complemental strand, 43315535 - 43315156
Alignment:
| Q |
4 |
ggagaagcagagatcagggaaggatgataatcacattgaccatcagattagtgctccagcttttgatgatgcttggtacaaatcctatgttgctgaaaaa |
103 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43315535 |
ggagaagaaaagatcagggaagaatgataatcacattgaccatcagactagtgctccagcttttgatgatgcttggtacaaatcctatgttgctgaaaaa |
43315436 |
T |
|
| Q |
104 |
cagaaacagaatgagcataacaaaaatgcaatttttgtgaggtcattaagccatggcagtggcagaaagtcattgttatttggaagcaaggagatgttgg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
43315435 |
cagaaacagaatgagcataacaaaaatgcaatttttgtgaggtcattaagccatggcagtggcagaaagtcattgttatttggaagcaaagagatgttgg |
43315336 |
T |
|
| Q |
204 |
ctgctgtgaagattcaaacttttttcagaggctatttggtatgtgaatatcaccaacttttgtattctaggaaagtttatgttaaattgttttaggaatg |
303 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43315335 |
ctgctgtgaagattcaaacttttttcagaggctatttggtatgtgaatgtcaccaacttttgtattctaggaaagtttatgttaaattgttttaggaatg |
43315236 |
T |
|
| Q |
304 |
tttttatttgctcatatgtgagtctctttccacaaattaatgtcattttctgaatttgattgttttgtaaatggtaatgct |
384 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43315235 |
tttttatttgctcatatgt-tgtctctttccacaaattaatgtcattttctgaatttgattgttttgtaaatggtaatgct |
43315156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 202 - 247
Target Start/End: Original strand, 4609107 - 4609152
Alignment:
| Q |
202 |
ggctgctgtgaagattcaaacttttttcagaggctatttggtatgt |
247 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
4609107 |
ggctgctgtaaagattcaaactttcttcagaggctatttggtatgt |
4609152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University