View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9697_low_14 (Length: 229)
Name: NF9697_low_14
Description: NF9697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9697_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 100; Significance: 1e-49; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 8 - 127
Target Start/End: Original strand, 26020548 - 26020667
Alignment:
| Q |
8 |
ttgattgggagagcacaagttcctcgaactacctatgtggtatttgtataagaatacacaagtaactgctgcaaactaattgtaatggttagctctcgac |
107 |
Q |
| |
|
|||| ||| |||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
26020548 |
ttgagtggtagagtacaagttcctcgaactacctatgtgatatttgtataagaatacacaagtaactgctgcaaactaattgtaatggttagctctcaac |
26020647 |
T |
 |
| Q |
108 |
actcaagttggacatatata |
127 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
26020648 |
actcaagttggacatatata |
26020667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 8 - 120
Target Start/End: Original strand, 26233204 - 26233324
Alignment:
| Q |
8 |
ttgattgggagagcacaagttcctcgaactacctatgtggtatttgtataagaatacacaagtaactgctgcaaactaattg--------taatggttag |
99 |
Q |
| |
|
|||| |||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
26233204 |
ttgagtgggagagtagaagttcctcgaactacctatgtggtatttgtataagaatacacaagtaactgttgcaaactaattgcatgctaataatggttag |
26233303 |
T |
 |
| Q |
100 |
ctctcgacactcaagttggac |
120 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
26233304 |
ctctcgacactcaagttggac |
26233324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 191 - 229
Target Start/End: Complemental strand, 26229380 - 26229342
Alignment:
| Q |
191 |
attggctattacaattgtgacaaacaagtcaatttaact |
229 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||| |
|
|
| T |
26229380 |
attggctaatccaattgtgacaaacaagtcaatttaact |
26229342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University