View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9697_low_15 (Length: 229)
Name: NF9697_low_15
Description: NF9697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9697_low_15 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 46145872 - 46145650
Alignment:
| Q |
7 |
gttcaatgggtcacaccatatgtacaaaagggtgtttttaaacatattgctgatccaaaattgaaagggaattttgatttagagcaattgaaatctgtga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46145872 |
gttcaatgggtcacaccatatgtacaaaagggtgtttttaaacatattgctgatccaaaattgaaagggaattttgatttagagcaattgaaatctgtga |
46145773 |
T |
 |
| Q |
107 |
ttatgatagctgtgaggtgcactgatagtagtcctgataaaaggcctagcatgatagaggtggtggaatggcttaaggatggtatttcaaagagnnnnnn |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
46145772 |
ttatgatagctgtgaggtgcactgatagtagtcctgataaaaggcctagcatgatagaggtggtggaatggcttaaggatggtgtttcaaagagaaaaaa |
46145673 |
T |
 |
| Q |
207 |
ngagattccaaatttgagtaaca |
229 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
46145672 |
agagattccaaatttgagtaaca |
46145650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University