View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9699_low_3 (Length: 359)
Name: NF9699_low_3
Description: NF9699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9699_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 134; Significance: 1e-69; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 97 - 344
Target Start/End: Original strand, 33183300 - 33183551
Alignment:
| Q |
97 |
agcttcacaccagattcaatccgtccaaaaaacacttctccatcatccacatccatcaattatttgagatctgtcact--gagtcttttagctaagcagt |
194 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||| |||| || ||||||||||||| ||||| |||||||||| |||||||| ||||| ||| | |
|
|
| T |
33183300 |
agcttcacaccagattcaatctgtccaaaaatcacttcttcatcttctacatccatcaattctttgatatctgtcactatgagtctttcagctatgcaat |
33183399 |
T |
|
| Q |
195 |
atgtgtcccttaatgcagcctcagcagcttgcttcaggtctttgactgttgcatgcagtggaaaagttacaatctcaccac--gacggccctttaaaatc |
292 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| | |||| | ||||||||||||| ||||| ||||||||||||||||| || |||||||| ||||| |
|
|
| T |
33183400 |
atgtgtcccttaatgcagcctcagcagtttgctttaagtctctaactgttgcatgcaatggaacagttacaatctcaccacaagatggcccttttaaatc |
33183499 |
T |
|
| Q |
293 |
agacttattattaatgaaattcgttttcaaatgacaaataaatgtcaaaact |
344 |
Q |
| |
|
||||||||| | || |||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
33183500 |
agacttattctcaacgaaattcggtttcaaatggcaaataaatgtcaaaact |
33183551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 32 - 98
Target Start/End: Original strand, 33183200 - 33183267
Alignment:
| Q |
32 |
atcatcttgtgctccacactcacacctcactt-ccaattatcacttcctccttgatatttcaatggag |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
33183200 |
atcatcttgtgctccacactcacacctcactttccaattatcacttcctccttgatatttcaatggag |
33183267 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University