View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9699_low_9 (Length: 270)
Name: NF9699_low_9
Description: NF9699
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9699_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 6 - 254
Target Start/End: Complemental strand, 42728394 - 42728146
Alignment:
| Q |
6 |
gtttggtgttacatgcacatcagttgacatagacataaattcaaacattatccaaatgtgtttttggcaaagtannnnnnnaattattaaaaagtgcaag |
105 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
42728394 |
gtttggagttacatgcacatcagttgacatagacataaattcaaacattatccaaatgtgtttttggcaaagtatttttttaattattaaaaagtgcaag |
42728295 |
T |
 |
| Q |
106 |
ataggttttaggcacacaagtattgagcgacacgtttcatagataaactcaggtgtagatatggtggtgcctataacgacggtagtttacatacatcgtt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42728294 |
ataggttttaggcacacaagtattgagcgacacgtttcatagataaactcaggtgtagatatggtggtgcctataacgacggtagtttacatacatcgtt |
42728195 |
T |
 |
| Q |
206 |
cttggtcatatgttataataagttcatttaggaatgtatgttatgtatt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42728194 |
cttggtcatatgttataataagttcatttaggaatgtatgttatgtatt |
42728146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University