View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9700_low_3 (Length: 390)
Name: NF9700_low_3
Description: NF9700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9700_low_3 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 23 - 275
Target Start/End: Original strand, 48176240 - 48176487
Alignment:
| Q |
23 |
atggctggttgggtaagagggcagcttggtgggtcgctgtctctggaccctggaaattgaaaatgatatatcaattgataaaaacaagtgattattctat |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48176240 |
atggctggttgggtaagagggcagcttggtgggttgctgtctctggaccctggaaattgaaaatgatatatcaattgataaaaacaagtgattattctat |
48176339 |
T |
|
| Q |
123 |
aatccaattgcctc-nnnnnnnatttctcgtttattcatttacttcttttcttcctaaaataaatctaaatcaacaaagggcccagctgagagcaccagc |
221 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
48176340 |
aatccaattgcctcttttttttatttctcgtttattcatttacttcttttcttcctaaaataaatc---at--acaaagggcccagctgagagcaccagc |
48176434 |
T |
|
| Q |
222 |
ttcgtatgctttcagattatttttcattaaaagaaaaatactttattaatagtt |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48176435 |
ttcgtatgctttcagattatttttcattaaaa-aaaaatactttattaatagtt |
48176487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 252 - 378
Target Start/End: Original strand, 48176534 - 48176660
Alignment:
| Q |
252 |
aagaaaaatactttattaatagttgtctattctcatattggtaaatgccgattcgacttattatagcatagcctcgtttgatttcttttgaccaatagta |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
48176534 |
aagaaaaatactttattaatagttgtctattctcatattggtcaatgccggttcgacttattatagcatagccttgtttgatttcttttgaccaatagta |
48176633 |
T |
|
| Q |
352 |
acattgttgatcttgcaatgatgtttc |
378 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
48176634 |
acattgttgatcttgcaatgatgtttc |
48176660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University