View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9700_low_5 (Length: 238)
Name: NF9700_low_5
Description: NF9700
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9700_low_5 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 26080127 - 26079905
Alignment:
| Q |
1 |
agtttgctcagggggagagttctcaagcattataagaactgtttgaaccatatctctaatcgatgtgggatctcgacatgtcccaagcaaaaagccaaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26080127 |
agtttgctcagggggagagttctcaagcattataagaactgtttgaaccatatctctaatcgatgtgggatctcgacatgtcccaagcaaaaagccaaaa |
26080028 |
T |
|
| Q |
101 |
agccagcaattgaatctaaacaattaaaaaatcttacagaagcagcccgttctgatttgagacgctttcccacaaagttggcaagcttctttgaataaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26080027 |
agccagcaattgaatctaaacaattaaaaaatcttacagaagcagcccgttctgatttgagacgctttcgcacaaagttggcaagcttctttgaataaat |
26079928 |
T |
|
| Q |
201 |
ttctcctttctcactgtcataac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26079927 |
ttctcctttctcactgtcataac |
26079905 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 128 - 190
Target Start/End: Complemental strand, 30597653 - 30597591
Alignment:
| Q |
128 |
aaaatcttacagaagcagcccgttctgatttgagacgctttcccacaaagttggcaagcttct |
190 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||| ||||| ||||| ||||||||||||| |
|
|
| T |
30597653 |
aaaagcttacagaagcagctcgttctgatttgagacgttttccaacaaatttggcaagcttct |
30597591 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University