View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9701_high_9 (Length: 231)
Name: NF9701_high_9
Description: NF9701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9701_high_9 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 7 - 231
Target Start/End: Original strand, 15568613 - 15568835
Alignment:
| Q |
7 |
ttactcagcttggaggacctgatagtactattctttcactactctttttctttctattctcactcaccctttttgttaannnnnnnnatatttggatcac |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||| ||||||||| || |||| |||| |
|
|
| T |
15568613 |
ttactcagcttggaggacctgatagtactattctttcactactctttttctttctcttctcatgcaccttttttgtta--tttttatatgtttgaatcaa |
15568710 |
T |
 |
| Q |
107 |
tactaagatatttatgatggtttcttaaaattttcagaggccactcctaaaactatcatgagggttatgggtgtgaagggtcttaccctttaccatctca |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15568711 |
tactaagatatttatgatggtttcttaaatttttcagaggccactcctaaaactatcatgagggttatgggtgtgaagggtcttaccctttaccatctca |
15568810 |
T |
 |
| Q |
207 |
agagccatcttcaggtttgaataca |
231 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
15568811 |
agagccatcttcaggtttgaataca |
15568835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University