View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9701_low_14 (Length: 247)
Name: NF9701_low_14
Description: NF9701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9701_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 35383876 - 35383627
Alignment:
| Q |
1 |
aagagttataaacaacaaaaagctccctttaacttgtgacaaaactgcaattagtctccctcaagatcacacacatgctaa----gagataatggagaga |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
35383876 |
aagagttataaacaacaaaaagctccctttaacttgtgacaaaactgtaattagtctccctcaagatcacacacatgctaattaagagataatggagaga |
35383777 |
T |
 |
| Q |
97 |
atgagaagagaggaaaagaaaagtaaaaaccatttggctagttcctctgaaggtgctctagaattgtcattgaatggagagctcaatcctggagataacc |
196 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35383776 |
atgagaagagaagaaaagaaaagtaaaaaccatttggctagttcctttgaaggtgctctagaattgtcattgaatggagaactcaatcctggagataacc |
35383677 |
T |
 |
| Q |
197 |
caccaaaaattggtgatgaagtggcaggtgatgacatgtctgtgctgctc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
35383676 |
caccaaaaattggtgatgaagtggcaggtgatgacatgtttgtgttgctc |
35383627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University