View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9701_low_24 (Length: 210)
Name: NF9701_low_24
Description: NF9701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9701_low_24 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 23 - 199
Target Start/End: Complemental strand, 24001323 - 24001139
Alignment:
| Q |
23 |
aggaacaaagtctgcttgcataggtcatgaagtcgtagctttttatttgcaggggtatccatcatcaaagtatagtgaagttgaagaaattgaaaaaccc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24001323 |
aggaacaaagtctgcttgcataggtcatgaagtcgtagctttttatttgcaggggtatccatcatcaaagtatagtgaggttgaagaaattgaaaaaccc |
24001224 |
T |
|
| Q |
123 |
taaaaca--------tatcaacgcaaatccattctgcaaatgcggcaagagagttgaaaaaaccctaacacgtaacaccaaactc |
199 |
Q |
| |
|
||| ||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
24001223 |
taacacatgcaactctatcaacgcaaatccattctgcaaatgcggcaagagagttgaacaaaccctaacacgtaccaccaaactc |
24001139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 23 - 188
Target Start/End: Complemental strand, 24009507 - 24009333
Alignment:
| Q |
23 |
aggaacaaagtctgcttgcataggtcatgaagtcgtagctttttatttgcaggggtatccatcatcaaagtatagtgaagttgaagaa-attgaaaaacc |
121 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||||||||| | |||||||||||| |||| || ||||| ||||||||||| || ||||||| |
|
|
| T |
24009507 |
aggaacaaagtctgcttggataggtcatgaagtcgtatctttttattcggaggggtatccataatcatagaatagttaagttgaagaagatgaaaaaacc |
24009408 |
T |
|
| Q |
122 |
ctaaaaca--------tatcaacgcaaatccattctgcaaatgcggcaagagagttgaaaaaaccctaacacgta |
188 |
Q |
| |
|
|||| ||| |||||| ||| ||| |||||||||||||||| |||||||| | |||||||||| ||||| |
|
|
| T |
24009407 |
ctaacacatgcaactctatcaaagcagatcaattctgcaaatgcggcgagagagttaacaaaaccctaagacgta |
24009333 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University