View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9701_low_8 (Length: 282)
Name: NF9701_low_8
Description: NF9701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9701_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 5 - 264
Target Start/End: Original strand, 6169765 - 6170021
Alignment:
| Q |
5 |
gaggagaagcataggaaacattacaaaatttggaaggtttattggaacaatgggatgaagttgctgctgctattattatttacaaacataggattttctg |
104 |
Q |
| |
|
||||| || ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169765 |
gaggataaacatagaaaacattacaaaatttggaaggtttattggaacaatgggatgaagttgctgctgctattattatttacaaacataggattttctg |
6169864 |
T |
|
| Q |
105 |
caatgtcaatagcctcatttgtcccgttggtgttttcaaatcgaccaacgtaacgtgtacactttcatccattcgtcgacaacttttgttccaaaaaagg |
204 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
6169865 |
caatgtcaatagcttcatttgtcccgttggtgttttcaaatcgaccaatgtaacgtgtacactttcatgcattcgtcgacaacttttgttccaaaaaagg |
6169964 |
T |
|
| Q |
205 |
atgagggtttctactactaatctctacatgatcactcgcactggtcatgcttcattcatc |
264 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6169965 |
atgagggttt---ctactaatctctacatgatcactcgcactggtcatgcttcattcatc |
6170021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University