View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9702_low_10 (Length: 336)
Name: NF9702_low_10
Description: NF9702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9702_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 298; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 24 - 329
Target Start/End: Complemental strand, 45251201 - 45250896
Alignment:
| Q |
24 |
acgatatcatgataatttctcatatatttgtaactgagctacattgtggtcacaactactcataactgcactattggcttcatctgagttcaaaaaggat |
123 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45251201 |
acgatatcacgataatttctcatatatttgtaactgagctacattgtggtcacaactactcataactgcactattggcttcatctgagttcaaaaaggat |
45251102 |
T |
|
| Q |
124 |
taagtagaggccgtgcacgtggttatataaagttacataagcatcgacttgttctttaacaaaaatatttgtcaacatggcatcatttttataatccttt |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
45251101 |
taagtagaggccgtgcacgtggttatataaagttacataagcatcgacttgttctttaacaaaaatatttgtcaacatggcatcatttttataatccctt |
45251002 |
T |
|
| Q |
224 |
ttctttgtgtatgcattcatttttgtttacaacataactgatttctgctaaagcccttctttgtctgctgatcagatgatcctatcatttgagcttccct |
323 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45251001 |
ttctttgtgtatgcattcatttttgtttacaacataactgatttctgctaaagcccttctttgtctgctgatcagatgatcctatcatttgagcttccct |
45250902 |
T |
|
| Q |
324 |
ttgctt |
329 |
Q |
| |
|
|||||| |
|
|
| T |
45250901 |
ttgctt |
45250896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 80; Significance: 2e-37; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 230 - 329
Target Start/End: Original strand, 42290332 - 42290431
Alignment:
| Q |
230 |
gtgtatgcattcatttttgtttacaacataactgatttctgctaaagcccttctttgtctgctgatcagatgatcctatcatttgagcttccctttgctt |
329 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42290332 |
gtgtatgcattcatttttgtttagaacagaactgatttatgctaaagcccttctttgtttgctgataagatgatcctatcatttgagcttccctttgctt |
42290431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University