View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9702_low_12 (Length: 310)
Name: NF9702_low_12
Description: NF9702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9702_low_12 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 11 - 310
Target Start/End: Original strand, 48961179 - 48961478
Alignment:
| Q |
11 |
gcatagggagaatcaaaatcacagcaatggtgaattccataggcagactcaaaatcacagcaattcttcccatcatggaaaacacattactgtgaaagga |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961179 |
gcatagggagaatcaaaatcacagcaatggtgaattccataggcagactcaaaatcacagcaattcttcccatcatggaaaacacattactgtgaaagga |
48961278 |
T |
 |
| Q |
111 |
agagaatccagcaaggagaaaaagttttcagattctgaggactctggcatgagagtgataacaattgcaggggaaaacagaggagcctatatggaactag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961279 |
agagaatccagcaaggagaaaaagttttcagattctgaggactctggcatgagagtgataacaattgcaggggaaaacagaggagcctatatggaactag |
48961378 |
T |
 |
| Q |
211 |
ttcaatcccaaaagaaacaccaacccaattatcttcacaagaaggggaacacaatcaaagttgatggtggtgaatctgagagttcaagtgctgatgaagg |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
48961379 |
ttcaatcccaaaagaaacaccaacccaattatcttcacaagaaggggaacacaatcaaagttgacggtggtgaatctgagagttcaagtgctgatgaagg |
48961478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University