View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9702_low_8 (Length: 367)
Name: NF9702_low_8
Description: NF9702
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9702_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 3e-67; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 15 - 177
Target Start/End: Complemental strand, 28715751 - 28715589
Alignment:
| Q |
15 |
atatttcaccaaaaacaacttaaagaaaatagcataaataaaatctgcaacattaaattagcttaaacagaaacaacttaaacaaaatgagcttagnnnn |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
28715751 |
atatttcaccaaaaacaacttaaagaaaatagcataaataaaatctgcaacattaaattagcttaaacagaaacaacttaaacaaaatgagcctaaaaag |
28715652 |
T |
|
| Q |
115 |
nnncagctttaacacatgtatgatgtttttaagcttcattccgtattacatgcatatttcacc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28715651 |
aaacagctttaacacatgtatgatgtttttaagcttcatttcgtattacatgcatatttcacc |
28715589 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 238 - 290
Target Start/End: Complemental strand, 28715529 - 28715477
Alignment:
| Q |
238 |
cctttgacagaaacagctataaatagcatatcagtgtccttaacaatgtttgt |
290 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
28715529 |
cctttgacagaaacagctataaatagcatataagtgtccttaacaatgtttgt |
28715477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 44; E-Value: 6e-16
Query Start/End: Original strand, 124 - 175
Target Start/End: Complemental strand, 28730517 - 28730466
Alignment:
| Q |
124 |
taacacatgtatgatgtttttaagcttcattccgtattacatgcatatttca |
175 |
Q |
| |
|
|||||||| |||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28730517 |
taacacatttatgatgtttttaagcttcatttcgtattacatgcatatttca |
28730466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University