View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9703_high_28 (Length: 282)
Name: NF9703_high_28
Description: NF9703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9703_high_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 20 - 271
Target Start/End: Complemental strand, 52315918 - 52315667
Alignment:
| Q |
20 |
gttgattcctcttgttgttcatctttctttgttgagtttactgtatcctcttcctcttttagttccttagtttccgtaacaacaacaaccttacgaggcc |
119 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52315918 |
gttgagtcctcttgttgttcatctttctttgttgagtttactgtatcctcttcctcttttagttccttagtttccgtaacaacaacaaccttacgaggcc |
52315819 |
T |
|
| Q |
120 |
ttcctctcttccgacgaggagcttcttctggttcacctccttctgttgatgcagcagcatcctcagctagcgctactgatgaaagttcctttgttttctg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52315818 |
ttcctctcttccgacgaggagcttcttctggttcacctccttctgttgatgcagcagcatcctcagctagcgctactgatgaaagttcctttgttttctg |
52315719 |
T |
|
| Q |
220 |
tcgctttttccccataaataaatacttctattattttctacatcagctctct |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52315718 |
tcgctttttccccataaataaatacttctattattttctacatcagctctct |
52315667 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University