View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9703_low_14 (Length: 423)
Name: NF9703_low_14
Description: NF9703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9703_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 173; Significance: 7e-93; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 173; E-Value: 7e-93
Query Start/End: Original strand, 19 - 203
Target Start/End: Original strand, 33654855 - 33655039
Alignment:
| Q |
19 |
atactacctttttctccgtctccattggaagttatatagtttatgttacggataactaccttccttgacgatttctttccatgtttcttgttgcttcgct |
118 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33654855 |
atactacctttttctccgtctcccttggaagttatatagtttatgttacggataactactttccttgacgacttctttccatgtttcttgttgcttcgct |
33654954 |
T |
 |
| Q |
119 |
ttgaattgtcatctgaatcactctcataagtagactcagaggatgcagttgactcgtcttcttcagagtgatccaatacctgaga |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33654955 |
ttgaattgtcatctgaatcactctcataagtagactcagaggatgcagttgactcgtcttcttcagagtgatccaatacctgaga |
33655039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 231 - 407
Target Start/End: Original strand, 33655067 - 33655243
Alignment:
| Q |
231 |
atgagaatccatttcttggtcatgaacgatgtgagagcgatccccgtttggaggccattgcatattcccaggataatacggagacggaacctgcatacca |
330 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33655067 |
atgagaatccatttcttggtcatgaacaatgtgagagcgatccccgtttggaggccattgcatattcccaggataatacggagacggaacctgcatacca |
33655166 |
T |
 |
| Q |
331 |
ggatacatgtatccttggtatggaggtgtttgttgaaatccatgaccctgaaaattgtgaatgtagtgtggatgatg |
407 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
33655167 |
ggatacatgtatccttggtatggaggcgtttgttgaaatgcatgaccctgaaaattgtgaatgtactgtggatgatg |
33655243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University