View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9703_low_15 (Length: 421)
Name: NF9703_low_15
Description: NF9703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9703_low_15 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 161; Significance: 1e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 161; E-Value: 1e-85
Query Start/End: Original strand, 219 - 414
Target Start/End: Complemental strand, 4572092 - 4571903
Alignment:
| Q |
219 |
tcatcactcactcttggttatgctaaagattcatcatttcttaagctctcatcaatgcaagtgatggaaaaagatgcatcacaatcacaaccttgttgca |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
4572092 |
tcatcactcactcttggttatgctaaagattcatcatttcttaagctctcatcaatgcaagtgatgga------tccatcacaatcacaaccttgttgca |
4571999 |
T |
|
| Q |
319 |
caaacttgcaggatggtgagaaaaatgcattctcaccttcttctgcaagaaattcagctttaccaaacaggtctcagaaaaggtactcctttgctt |
414 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4571998 |
caaacttgcaagatggtgagaaaaatacattctcaccttcttctgcaagaaattcagctttaccaaacaggtctcagaaaaggtactcctttgctt |
4571903 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 131; E-Value: 8e-68
Query Start/End: Original strand, 19 - 157
Target Start/End: Complemental strand, 4572292 - 4572154
Alignment:
| Q |
19 |
attcaattcaacttgtttcaatctagaaaaaggaagaataagaaagttgaagaaattttgtaagcaacaagatgtggcaaagaagccacaagtgttcttt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4572292 |
attcaattcaacttgtttcaatctagaaaaaggaagaataagaaagttgaagaaattttgtaagcaataagatgtggcaaagaagccacaagtgttcttt |
4572193 |
T |
|
| Q |
119 |
agaggagaggaagttggagctcagacttggtccacctgg |
157 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4572192 |
agaggagaggaagttggagcttagacttggtccacctgg |
4572154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University