View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9703_low_39 (Length: 291)
Name: NF9703_low_39
Description: NF9703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9703_low_39 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 10 - 276
Target Start/End: Complemental strand, 36641310 - 36641049
Alignment:
| Q |
10 |
cgtaggagaaaatatccttgatgctaccgtttcagagaaccttccaggtacttcctaatggctagtggatttggattctttattgtttttctctagcata |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36641310 |
cgtaggagaaaatatccttgatgctaccgtttcagagaaccttccaggtacttcctaatggctagtggatttggattctttattgtttttctgtagcata |
36641211 |
T |
|
| Q |
110 |
ttgaggagagaattacactatttgtatcacataagaacttaattatcatgattatgtcttttaaaggatttacaagactggcttggagnnnnnnnnnnct |
209 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| || |
|
|
| T |
36641210 |
ttggggagagaattacactatttgtatcacataagaacttaattatcatgattatgtctttcaaaggatttacaagactggcttggag-tttttttttct |
36641112 |
T |
|
| Q |
210 |
tcactaacaaattaatatggcaagtgttggttgctgattgctatctgttcacaaactatgaaggaat |
276 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36641111 |
tcactaaca----aatatggcaagtgttggttgctgattgctatctgttcacaaactatgaaggaat |
36641049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University