View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9703_low_53 (Length: 244)
Name: NF9703_low_53
Description: NF9703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9703_low_53 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 25 - 231
Target Start/End: Original strand, 27450451 - 27450659
Alignment:
| Q |
25 |
agttcaagtggtttaaaataatatgaggctcactagatgtagtnnnnnnnn-cacaaatgaatttt-ttgttatttcaaaatggtttatccacaaataac |
122 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||| ||||||||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27450451 |
agttcaagtagtttaaaataatgtgaggctcactagatgtagtaaaaaaaaacacaaatgagtttttttgttatttcaaaatggtttatccacaaataac |
27450550 |
T |
|
| Q |
123 |
agaattttaatatcctttaactttgaacaaacaaagaaaacttatacatttcatgtctaacaagagaaaactttgcactgcaggtgatgtttagtaccga |
222 |
Q |
| |
|
|||||||||||||||||||||| |||| || ||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27450551 |
agaattttaatatcctttaactgtgaataatcaaagaaaacttatacattcaatgtctaataagagaaaactttgcactgcaggtgatgtttagtaccga |
27450650 |
T |
|
| Q |
223 |
tgcctatgc |
231 |
Q |
| |
|
||||||||| |
|
|
| T |
27450651 |
tgcctatgc |
27450659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University