View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9703_low_57 (Length: 242)
Name: NF9703_low_57
Description: NF9703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9703_low_57 |
 | |
|
| [»] chr8 (4 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 242
Target Start/End: Original strand, 2365700 - 2365925
Alignment:
| Q |
17 |
agcaacatactaagtttcaattggatgtttgcaatgaacattttcatttggtattactatctttttatttgaatgtgtgtggatgttcgatgtatgtata |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2365700 |
agcaacatactaagtttcaattggatgtttgcaatgaacattttcatttggtattactatctttttatttgaatgtgtgtggatgttcgatgtatgtata |
2365799 |
T |
|
| Q |
117 |
tgaaagccctcaactttatttagggtctgtttggattgccttatttgcagatatttcttgtttgcaaatgccacaatttgtttgaagcagttggtagaat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2365800 |
tgaaagccctcaactttatttagggtctatttggattgccttatttgcagatatttcttgtttgcaaatgccacaatttgtttgaagcagttggtagaat |
2365899 |
T |
|
| Q |
217 |
catatcctgggcccttgcagatagtt |
242 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
2365900 |
catatcctgggcccttgcagatagtt |
2365925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 161 - 242
Target Start/End: Original strand, 2353692 - 2353773
Alignment:
| Q |
161 |
ttgcagatatttcttgtttgcaaatgccacaatttgtttgaagcagttggtagaatcatatcctgggcccttgcagatagtt |
242 |
Q |
| |
|
||||||| |||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
2353692 |
ttgcagacatttcttgtttgcaaatgccccaatttctttcaagcagttggtagaatcatatcctggacccttgcagttagtt |
2353773 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 161 - 242
Target Start/End: Original strand, 2361621 - 2361702
Alignment:
| Q |
161 |
ttgcagatatttcttgtttgcaaatgccacaatttgtttgaagcagttggtagaatcatatcctgggcccttgcagatagtt |
242 |
Q |
| |
|
||||||| |||||||||||||||||| | | |||| ||| |||||||||||||||||||||||||| ||||||||| ||||| |
|
|
| T |
2361621 |
ttgcagacatttcttgtttgcaaatgtctcgatttctttcaagcagttggtagaatcatatcctggtcccttgcagttagtt |
2361702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 107 - 161
Target Start/End: Original strand, 2369193 - 2369246
Alignment:
| Q |
107 |
tgtatgtatatgaaagccctcaactttatttagggtctgtttggattgccttatt |
161 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||| |||||| |
|
|
| T |
2369193 |
tgtatgtatatgaaagcccttaactttattta-ggtctgtttggattgtcttatt |
2369246 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University