View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9703_low_62 (Length: 239)
Name: NF9703_low_62
Description: NF9703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9703_low_62 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 78 - 221
Target Start/End: Original strand, 26411346 - 26411490
Alignment:
| Q |
78 |
agaagaatttccagatgaaaagttgttcgc-attagagaaagaccatggtttactgatatgacaaacttcaaagcagcaggtgagattccagaagtttac |
176 |
Q |
| |
|
||||||||||||||||||||| |||||| | || ||| ||| |||||| ||| |||| |||||||||| ||||| |||||||||||||||| ||| |||| |
|
|
| T |
26411346 |
agaagaatttccagatgaaaaattgttcaccatgagaaaaacaccatgatttgctgacatgacaaactacaaagtagcaggtgagattccaaaagattac |
26411445 |
T |
|
| Q |
177 |
aattgggaacaaagacataaattcctctgggaagctgcacactat |
221 |
Q |
| |
|
||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26411446 |
aatcgggaacaaagacataaattcctccgggaagctgcacactat |
26411490 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 1 - 83
Target Start/End: Original strand, 26406474 - 26406556
Alignment:
| Q |
1 |
ggaacaaaaaatttagttcctgatcatttgtcaagattggcgaataacgaagccactaacaaggaaaaagaaatataagaaga |
83 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
26406474 |
ggaacaaagaatttagttcctgatcatttgtcaagattggcgaataacgaagccactaacaaagaaaaagaaatataagaaga |
26406556 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University