View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9703_low_65 (Length: 234)
Name: NF9703_low_65
Description: NF9703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9703_low_65 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 20 - 204
Target Start/End: Complemental strand, 42222363 - 42222179
Alignment:
| Q |
20 |
tgtgatccaccaatagtccattgtgatctgaaacctgccaatgtcctactagatgaaaatatggttgcacatgtggcagattttggattggcaagatttc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42222363 |
tgtgatccaccaatagtccattgtgatctgaaacctgccaatgtcctactagatgaggatatggttgcacatgtggcagattttggattggcaaggtttc |
42222264 |
T |
|
| Q |
120 |
tctctcaaaatccatcatagaaacatagtagcactctggaactgaagggatcgatcggctatattgccccaggtacttactaatg |
204 |
Q |
| |
|
| ||||||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
42222263 |
tttctcaaaatccatcagagaaacataacagcactctagaactgaagggatcgatcggctatatcgcgccaggtacttactaatg |
42222179 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 20 - 200
Target Start/End: Complemental strand, 42210138 - 42209958
Alignment:
| Q |
20 |
tgtgatccaccaatagtccattgtgatctgaaacctgccaatgtcctactagatgaaaatatggttgcacatgtggcagattttggattggcaagatttc |
119 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||| |||||||||||| |||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
42210138 |
tgtgacccaccaatagtccattgtgatctgaaacctgtcaatgttctactagatgaagatatggttgcacatgtagcagattttggattggcaaggtttc |
42210039 |
T |
|
| Q |
120 |
tctctcaaaatccatcatagaaacatagtagcactctggaactgaagggatcgatcggctatattgccccaggtacttact |
200 |
Q |
| |
|
||||||||||||||||| ||||||||| ||||| || |||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
42210038 |
tctctcaaaatccatcagagaaacataacagcaccctagaactgaagggatcaatcggctatatcgccccaggtacttact |
42209958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University