View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9703_low_66 (Length: 228)
Name: NF9703_low_66
Description: NF9703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9703_low_66 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 210
Target Start/End: Original strand, 3714197 - 3714401
Alignment:
| Q |
1 |
ataagcgacaaatatcatttcaacaaggttccatgtaacatgacatgacacacccttcatatcccactgtctctgtcagaaattagacgctagaaagtaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3714197 |
ataagcgacaaatatcatttcaacaaggttccatgtaacatgacatgacacacccttcatatcccactgtctctgtcagaaattagacgctagaaagtaa |
3714296 |
T |
|
| Q |
101 |
gatgttgattttcatacttcatattttgttacagatgtacatgcacattatcacaatttcaacagttaataatcaaatcaaatcaaatcaatggcactta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
3714297 |
gatgttgattttcatacttcatattttgttacagatgtacatgcacattatcacaatttcaacagttaataatc-----aaatcaaatcgatggcactta |
3714391 |
T |
|
| Q |
201 |
tcactttact |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
3714392 |
tcactttact |
3714401 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 31 - 70
Target Start/End: Complemental strand, 17032351 - 17032312
Alignment:
| Q |
31 |
ccatgtaacatgacatgacacacccttcatatcccactgt |
70 |
Q |
| |
|
||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
17032351 |
ccatgtaacatgacaagacacacccttcataacccactgt |
17032312 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University