View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9703_low_68 (Length: 218)
Name: NF9703_low_68
Description: NF9703
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9703_low_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 105; Significance: 1e-52; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 105; E-Value: 1e-52
Query Start/End: Original strand, 90 - 198
Target Start/End: Original strand, 14281672 - 14281780
Alignment:
| Q |
90 |
ttagggttggaacagaagattgctatcttctcggcatgctggacatccccgacatgctgtcatcttctttaccaatgttgcttttgaggtaacaaactgc |
189 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14281672 |
ttaggggtggaacagaagattgctatcttctcggcatgctggacatccccgacatgctgtcatcttctttaccaatgttgcttttgaggtaacaaactgc |
14281771 |
T |
 |
| Q |
190 |
ttcttgtta |
198 |
Q |
| |
|
||||||||| |
|
|
| T |
14281772 |
ttcttgtta |
14281780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University